Skip to main content

Table 1 Gene and primer information used in this study.

From: Curcumin and resveratrol inhibit nuclear factor-kappaB-mediated cytokine expression in adipocytes

Gene GenBank no. 5' primer – top sequence
3' primer – bottom sequence
Intron flanked Base pairs amplified
COX-2 NM_011198 TGGGGTGATGAGCAACTATT
AAGGAGCTCTGGGTCAAACT
7 132
IL-1β NM_008361 GACCTTCCAGGATGAGGACA
AGCTCATATGGGTCCGACAG
3 183
IL-6 NM_031168 AGTTGCCTTCTTGGGACTGA
CAGAATTGCCATTGCACAAC
2 191
TNFα NM_013693 ACGGCATGGATCTCAAAGAC
GTGGGTGAGGAGCACGTAGT
none 116
β-actin NM_007393 CCTGAACCCTAAGGCCAACC
CAGCTGTGGTGGTGAAGCTG
3 287
leptin NM_008493 TGACACCAAAACCCTCATCA
TCATTGGCTATCTGCAGCAC
2 213
F4/80 NM_010130 GCTGTGAGATTGTGGAAGCA
CTGTACCCACATGGCTGATG
15 135
Mac-1 NM_008401 AAGGATTCAGCAAGCCAGAA
TAGCAGGAAAGATGGGATGG
20 136