Skip to main content

Advertisement

Table 1 Gene and primer information used in this study.

From: Curcumin and resveratrol inhibit nuclear factor-kappaB-mediated cytokine expression in adipocytes

Gene GenBank no. 5' primer – top sequence 3' primer – bottom sequence Intron flanked Base pairs amplified
COX-2 NM_011198 TGGGGTGATGAGCAACTATT AAGGAGCTCTGGGTCAAACT 7 132
IL-1β NM_008361 GACCTTCCAGGATGAGGACA AGCTCATATGGGTCCGACAG 3 183
IL-6 NM_031168 AGTTGCCTTCTTGGGACTGA CAGAATTGCCATTGCACAAC 2 191
TNFα NM_013693 ACGGCATGGATCTCAAAGAC GTGGGTGAGGAGCACGTAGT none 116
β-actin NM_007393 CCTGAACCCTAAGGCCAACC CAGCTGTGGTGGTGAAGCTG 3 287
leptin NM_008493 TGACACCAAAACCCTCATCA TCATTGGCTATCTGCAGCAC 2 213
F4/80 NM_010130 GCTGTGAGATTGTGGAAGCA CTGTACCCACATGGCTGATG 15 135
Mac-1 NM_008401 AAGGATTCAGCAAGCCAGAA TAGCAGGAAAGATGGGATGG 20 136