Skip to main content

Table 1 Primer sequences and corresponding probe numbers for real-time RT-PCR analysis

From: Identification of the Eph receptor pathway as a novel target for eicosapentaenoic acid (EPA) modification of gene expression in human colon adenocarcinoma cells (HT-29)

Gene Forward primer Reverse primer Roche Universal Probe Library probe
EphB4 gcccgtcatgattctcaca gaactgtccgtcgtttagcc 12
EphA1 gcatgaaacgctacatcctg gtgattcccatctgcgtca 67
Vav2 catcaaggtggaggtgcag gtacttggcctcggtctcct 67
β-actin ccaaccgcgagaagatga ccagaggcgtacagggtag 64