Skip to main content

Advertisement

Table 1 Primers and annealing temperatures for PCR amplification of each gene studied.

From: Changes in white adipose tissue metabolism induced by resveratrol in rats

SYBR® Green RT-PCR:
Primers Sense primer Antisense primer Annealing Temperature
ACC 5'-GGACCACTGCATGGAATGTTAA-3' 5'-TGAGTGACTGCCGAAACATCTC-3' 60.6°C
FAS 5'-AGC CCC TCA AGT GCA CAG TG-3' 5'-TGCCAATGTGTTTTCCCTGA-3' 60.0°C
SREBP-1c 5'-GCGGACGCAGTCTGGG-3' 5'-ATGAGCTGGAGCATGTCTTCAAA-3' 67.3°C
ATGL 5'-CACTTTAGCTCCAAGGATGA-3' 5'-TGGTTCAGTAGGCCATTCCT-3' 62.0°C
Perilipin 5'-AGAGGAGACAGATGAGGAGGAAG -3' 5'-AGATGGTGTTCTGCAGAGTCTTC -3' 63.9°C
LPL 5'- CAGCTGGGCCTAACTTTGAG -3' 5'- CCTCTCTGCAATCACACGAA -3' 61.5°C
PPARγ 5'-ATTCTGGCCCACCAACTTCGG -3' 5'-TGGAAGCCTGATGCTTTATCCCCA -3' 64.5°C
β-Actin 5'-ACGAGGCCCAGAGCAAGAG-3' 5'-GGTGTGGTGCCAGATCTTCTC-3' 60.0°C
  1. ACC, acetyl-CoA carboxylase; FAS, fatty acid synthase; SREBP-1c, sterol-regulatory element binding protein-1c; ATGL, adipose triglyceride lipase; LPL, lipoprotein lipase; PPAR, peroxisome proliferator-activated receptor.