Skip to main content

Advertisement

Table 1 Primer sequences used for quantitative real-time polymerase chain reaction analysis.

From: Iron bioavailability from a tropical leafy vegetable in anaemic mice

Primer Sequence
mHepcidin 1-Forward AGAGCTGCAGCCTTTGCAC
mHepcidin 1-Reverse GAGGTCAGGATGTGGCTCTA
m18S-Forward GAATTCCCAGTAAGTGGCGGG
m18S-Reverse GGGCAGGGACTTAATCAACG