Skip to main content

Table 1 Primers used for real-time reverse transcription PCR

From: Does vitamin-D intake during resistance training improve the skeletal muscle hypertrophic and strength response in young and elderly men? – a randomized controlled trial

Target Sense primer Antisense primer Ref. sequence
RPLP0 GGAAACTCTGCATTCTCGCTTCCT CCAGGACTCGTTTGTACCCGTTG NM_053275.3
GAPDH CCTCCTGCACCACCAACTGCTT GAGGGGCCATCCACAGTCTTCT NM_002046.4
VDR CAGGCCCAACTCCAGACACACT ATCCAGATTGGAGAAGCTGGACGA NM_000376.2
CYP27B1 AAGCGCAGCTGTATGGGGAGAC GCTCAGGCTGCACCTCAAAATG NM_000785.3
Myostatin TTCGTCTGGAAACAGCTCCTA GGAGTCTCGACGGGTCTCAA NM_005259.2
\