Skip to main content

Advertisement

Table 2 Sequences of primers used in this study

From: Bacterial metabolites directly modulate farnesoid X receptor activity

Gene Forward Reverse Reference
GAPDH GAAGGTGAAGGTCGGAGT CATGGGTGGAATCATATTGGAA [45]
IBABP TCACTTGGTCCCAGCACTA CTTGTCACCCACGATCTCT [45]
OSTα CTACACCTGGGTGAGCAGAA AGAGGAATAGGGAGGCGAAC [46]
FGF19 CACGGGCTCTCCAGCTGCTTCCTGCG TCCTCCTCGAAAGCACAGTCTTCCTCCG [47]
SHP GGCTGGCAGTGCTGATTCAG TGGGGTGTGGCTGAGTGAAG [48]
Gapdh AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA [22]
Fxr TCCAGGGTTTCAGACACTGG GCCGAACGAAGAAACATGG [27]
Ibabp CAGGAGACGTGATTGAAAGGG GCCCCCAGAGTAAGACTGGG [27]
Ostα TGTTCCAGGTGCTTGTCATCC CCACTGTTAGCCAAGATGGAGAA [27]
Fgf15 ACGTCCTTGATGGCAATCG GAGGACCAAAACGAACGAAAT T [27]
Cyp7a1 AGCAACTAAACAACCTGCCAGTACTA GTCCGGATATTCAAGGATGCA [27]
Cyp7b1 TAGCCCTCTTTCCTCCACTCATA GAACCGATCGAACCTAAATTCCT [27]
Cyp8b1 GGCTGGCTTCCTGAGCTTATT ACTTCCTGAACAGCTCATCGG [27]
Shp CGATCCTCTTCAACCCAGATG AGGGCTCCAAGACTTCACACA [27]
Bsep CTGCCAAGGATGCTAATGCA CGATGGCTACCCTTTGCTTCT [27]
Ntcp ATGACCACCTGCTCCAGCTT GCCTTTGTAGGGCACCTTGT [27]
Ibat ACCACTTGCTCCACACTGCTT CGTTCCTGAGTCAACCCACAT [27]
  1. Genes in capitals indicate human genes, and those in lower case are mouse genes. Gapdh, Ibabp and Ostα were analyzed using the following conditions: 95 °C 2 min, 40 cycles of 95 °C for 10 s, and 60 °C for 30 s. Fgf19 was analyzed using the following conditions: 95 °C 15 min, 40 cycles of 95 °C for 15 s, and 62 °C for 30 s. All mouse genes were analyzed using the following conditions: 95 °C 2 min, 40 cycles of 95 °C for 15 s, and 60 °C for 60 s