Skip to main content

Advertisement

Table 2 List of primer/probe sets

From: Evaluation of markers of beige adipocytes in white adipose tissue of the mouse

Gene Forward primer Reverse primer Probe
UCP1 GCATTCAGAGGCAAATCAGC GCCACACCTCCAGTCATTAAG 56-FAM/ACTGAGTCG/Zen/TAGA GGCCAATCCTGA/3IABkFQ
CIDEA CATACATGCTCCGAGTACTGG CATCCCACAGCCTATAACAGAG 56-FAM/TAACCAGGG/Zen/CACA GCTACAGAGG/3IABkFQ
Cox8b AGCCAAAACTCCCACTTCC TCTCAGGGATGTGCAACTTC 56-FAM/AGATCCCCA/Zen/C AGCCTGCTCC/3IABkFQ
Serpina3k GCCAAAGTCAATAACCCCAAG CTTTGCAACAGCCAATCAGAG 56-FAM/AGCCCTGGA/Zen/C AGAATCATGAGAAC/3IABkFQ
Wdnm1-like GCCAGAGGAACAATGTGTCAG GTAATCTCCATACATGGCCTCC 56-FAM/TGGTCACAG/Zen/AGCT CCAAACAGACAC/3IABkFQ
ASC1 TCTTCATTTCCATCCCACTGG ATGACCCACGAAAAGTAGCC 56-FAM/ATGTCGCCT/Zen/ACTT CACTGCCATGT/3IABkFQ
FGF21 CAAATCCTGGGTGTCAAAGC CATGGGCTTCAGACTGGTAC 56-FAM/CTCCATCTG/Zen/GCTG TTGGCAAAGAAA/3IABkFQ
P2RX5 TGATAGTTAATGGCAAGGCGG TTGTCTCGGTAAAACTCGCTC 56-FAM/CCAGGTCAC/Zen/A GAAGAAAGCCCCA/3IABkFQ
PAT2 AGCCACCCCTCTCAATCT TGCCTTTGACCAGATGAACC 56-FAM/CCAGGATCC/Zen/C AGTCCAGCGAATG/3IABkFQ/
CITED1 ATTTATCGGACTTCTGCCCAG TTGCGATCCTTCACTCCAAG 56-FAM/AGGCCTCGA/Zen/CATA GTTGGCATTTCA/3IABkFQ
CAR4 CAGAGCACAGTATTGATGGGAG CTTGTTCACCTTGTCTCCTACC 56-FAM/TTGTCCTTC/Zen/GAGT CCTCCTTGCTAGA/3IABkFQ
TBX1 TGGGACGAGTTCAATCAGC TGTCATCTACGGGCACAAAG 56-FAM/TCCCCACGT/Zen/TCCA AGTGAAGCTTTT/3IABkFQ
CD137 CCTGTGATAACTGTCAGCCTG TCTTGAACCTGAAATAGCCTGC 56-FAM/TGCCCTCCA/Zen/AGTA CCTTCTCCAG/3IABkFQ
TMEM26 GCACCATCACTAGAGACCAAC ACAAGAATGCCAGAGACCAG 56-FAM/CGCCGTCCC/Zen/C ACAAACATCAGA/3IABkFQ
PDGFR-α GTTGCCTTACGACTCCAGATG TCACAGCCACCTTCATTACAG 56-FAM/TCCCAAAAT/Zen/CCGA CCAAGCACGA/3IABkFQ