Skip to main content

Advertisement

Table 2 The primers used for quantitative PCR

From: The effects on weight loss and gene expression in adipose and hepatic tissues of very-low carbohydrate and low-fat isoenergetic diets in diet-induced obese mice

Gene Forward primer (5' to 3') Reverse primer (5' to 3')
36B4 GGCCCTGCACTCTCGCTTTC TGCCAGGACGCGCTTGT
Adiponectin AAGAAGGACAAGGCCGTTCTCTT GCTATGGGTAGTTGCAGTCAGTT
Arg-1 CTCCAAGCCAAAGTCCTTAGAG AGGAGCTGTCATTAGGGACATC
BDH AGTTTGGGGTCGAGGCTTTC TGGTGGCCGCTATGAAGTTG
CD36 AATGGCACAGACGCAGCCT GGTTGTCTGGATTCTGGA
CD68antigen TGACCTGCTCTCTCTAAGGCTACA TCACGGTTGCAAGAGAAACATG
CD137 CGTGCAGAACTCCTGTGATAAC GTCCACCTATGCTGGAGAAGG
D2 GCACGTCTCCAATCCTGAAT TGAACCAAAGTTGACCACCA
Elovl6 TTCCGAGTCTCCCGGAAGT ACAGCCCATCAGCATCTGAGT
F4/80 TGACAACCAGACGGCTTGTG GCAGGCGAGGAAAAGATAGTGT
FAS GCTGCGGAAACTTCAGGAAAT AGAGACGTGTCACTCCTGGACTT
FGF21 ATGGAATGGATGAGATCTAGAGTTGG TCTTGGTCGTCATCTGTGTAGAGG
GRP120 GCATAGGAGAAATCTCATGG GAGTTGGCAAACGTGAAGGC
HADH ACTACATCAAAATGGGCTCTCAG AGCAGAAATGGAATGCGGACC
HMGCS2 ATCAACTCCCTGTGCCTGAC GCAATGTCACCACAGACCAC
Leptin GACACCAAAACCCTCAT CAGAGTCTGGTCCATCT
MCAD GATCGCAATGGGTGCTTTTGATAGAA AGCTGATTGGCAATGTCTCCAGCAAA
MCP-1 CTTCTGGGCCTGCTGTTCA CCAGCCTACTCATTGGGATCA
Mincle ACCAAATCGCCTGCATCC CACTTGGGAGTTTTTGAAGCATC
MR CCACAGCATTGAGGAGTTTG ACAGCTCATCATTTGGCTCA
NOS2 CAGCTGGGCTGTACAAACCTT CATTGGAAGTGAAGCGTTTCG
PGC1α AAGTGTGGAACTCTCTGGAACTG GGGTTATCTTGGTTGGCTTTATG
PPARα CCTCAGGGTACCACTACGGAGT GCCGAATAGTTCGCCGAA
PPARγ1 GAGTGTGACGACAAGATTTG GGTGGGCCAGAATGGCATCT
PPARγ2 TCTGGGAGATTCTCCTGTTGA GGTGGGCCAGAATGGCATCT
SCD1 CCCCTGCGGATCTTCCTTAT AGGGTCGGCGTGTGTTTCT
SREBP-1c GGAGCCATGGATTGCACATT CCTGTCTCACCCCCAGCATA
TBX1 GGCAGGCAGACGAATGTTC TTGTCATCTACGGGCACAAAG
TMEM26 ACCCTGTCATCCCACAGAG TGTTTGGTGGAGTCCTAAGGTC
UCP1 GGCCCTTGTAAACAACAAAATAC GGCAACAAGAGCTGACAGTAAAT
UCP2 ACCAAGGGCTCAGAGCATGCA TGGCTTTCAGGAGAGTATCTTTG
  1. 36B4 acidic ribosomal phosphoprotein P0, Arg arginase, BDH 3-hydroxybutyrate dehydrogenase, CD36 fatty acid translocase, D2 type 2 iodothyronine deiodinase, Elovl6 elongation of very long-chain fatty acid 6, FAS fatty acid synthase, FGF21 fibroblast growth factor 21, GPR G-protein-coupled receptor, HADH hydroxyacyl-coenzyme A dehydrogenase, HMGCS2 3-hydroxy-3-methylglutaryl-coenzyme A synthase 2, MCAD medium-chain acyl-CoA dehydrogenase, MCP monocyte chemoattractant protein, Mincle the macrophage inducible C-type lectin, MR mannose receptor, NOS nitric oxide synthase, PGC peroxisome proliferator-activated receptor γ coactivator, PPAR peroxisome proliferator-activated receptor, SCD1 stearoyl-CoA desaturase 1, SREBP sterol regulatory element-binding protein, TBX1 T-box 1 transcription factor C, TMEM26 transmembrane protein 26, UCP uncoupling protein