Skip to main content

Advertisement

Table 3 Primer sequences used for the determination of gene expression by RT-qPCR

From: Maternal dietary ratio of linoleic acid to alpha-linolenic acid during pregnancy has sex-specific effects on placental and fetal weights in the rat

Target Genes Sequence (5′-3′) Amplicon Size Accession Number
Fasn FWD: TGCTCCCAGCTGCAGGC 107 NM_017332
  REV: GCCCGGTAGCTCTGGGTGTA   
Lpl FWD: TTCCTGGATTAGCAGACTCTGTGT 89 NM_012598
  REV: TCCTGTCACCGTCCATCCAT   
Pparg FWD: CTCAGTGGAGACCGCCCA 75 NM_013124
  REV: CAGGGCCTGCAGCAGGT   
Srebf1 FWD: GATTGCACATTTGAAGACATGCTT 95 NM_001276708
  REV: CCTGTCTCACCCCCAGCATA   
Lep FWD: AGACCATTGTCACCAGGATCAAT 89 NM_013076
  REV: CCCGGGAATGAAGTCCAAA   
Actb FWD: GACCCAGATCATGTTTGAGACCTT 79 NM_031144
  REV: AGAGGCATACAGGGACAACACA   
  1. Fasn fatty acid synthase, Lpl lipoprotein lipase, Pparg peroxisome proliferator-activated receptor gamma, Srebf1 sterol regulatory element-binding protein 1, Lep leptin, Actb beta-actin