Skip to main content

Table 1 Primers used in the study

From: Ccr7 null mice are protected against diet-induced obesity via Ucp1 upregulation and enhanced energy expenditure

Gene Forward primer Reverse primer
Gapdh AATGTGTCCGTCGTGGATCTGA GATGCCTGCTTCACCACCTTCT
Ucp1 CACCTTCCCGCTGGACACT CCCTAGGACACCTTTATACCTAATGG
Cidea ATCACAACTGGCCTGGTTACG TACTACCCGGTGTCCATTTCT
Pgc1α AGCCGTGACCACTGACAACGAG GCTGCATGGTTCTGAGTGCTAA
Prdm16 CAGCACGGTGAAGCCATTC GCGTGCATCCGCTTGTG
Cd137 GGCCGTTTAGGAAAGGGACA CAGGAGTCATGCAGAGGCAA
Tmem26 GAAACCAGTATTGCAGCACCC CCCATTCCATTGGTGGCTCT
Th CCTGGAGTACTTTGTGCGCT GGGAACCAGGGAACCTTGTC
Tbx1 CCGGTGAAGAAGAACCCGAA AACATTCGTCTGCCTGCCTT
Dio2 CAGTGTGGTGCACGTCTCCAATC TGAACCAAAGTTGACCACCAG
Sirt1 GCATAGATACCGTCTCTTGATCTGAA TGTGAAGTTACTGCAGGAGTGTAAA
Adiponectin TGTTCCTCTTAATCCTGCCCA CCAACCTGCACAAGTTCCCTT
β-actin TCTTTGATGTCACGCACGAT TACAGCTTCACCACCACA