Skip to main content

Advertisement

Table 1 Primers of quantitative RT-PCR analysis

From: Perilipin5 protects against lipotoxicity and alleviates endoplasmic reticulum stress in pancreatic β-cells

NameForward/reverse primer sequences
PLIN5AGGGCTACTTTGTGCGTCTG; TTTGGGTGATGGAAAGTAGG
SREBP-1cGCTGAGTGCCCTGAACCTG; CCCATCCACGAAGAAACG
XBP-1(s)GAGTCCGCAGCAGGTG; GCGTCAGAATCCATGGGA
Cyclin D1TCTACACTGACAACTCTATCCG; TAGCAGGAGAGGAAGTTGTTGG
Cyclin D2AGACCTTCATCGCTCTGTGT; TAGCAGATGACGAACACGCC
BiPGCGGATCAAGGTGAAGAAAGG; CGCAAAGTCTACCCACAGGAAC
CHOPAAGGAGAAGGAGCAGGAGAATG; ATGCGGTCGATCAGAGCC
18S rRNAAGGGGAGAGCGGGTAAGAGA; GGACAGGACTAGGCGGAACA