Skip to main content

Advertisement

Table 2 Primer sequences used in quantitative real-time PCR assay

From: Excessive BCAA regulates fat metabolism partially through the modification of m6A RNA methylation in weanling piglets

PrimersAccession No.Sequences (5′ → 3′)Product size (bp)
PPAR-γNM_214379.1F-AACATTTCACAAGAGGTGACCA213
R-GATCTCGTGGACGCCATACT
SREBP-1cNM_214157.1F-AGCGGACGGCTCACAATG121
R-CGCAAGACGGCGGATTTA
ACACANM_001114269.1F-ACATCCCCACGCTAAACA186
R-AGCCCATCACTTCATCAAAG
FASNNM_001099930.1F-GCTTGTCCTGGGAAGAGTGTA115
R-AGGAACTCGGACATAGCGG
CD36NM_001044622.1F-ACCCTGAGACCCACACAGTC119
R-TACAGCTGCCACAGCCAGAT
FABP4NM_001002817.1F-TGAAAGGTGTCACGGCTAC102
R-TCGGGACAATACATCCAACAGAG
CPT-1AXM_021091195.1F-ATTACGACGGCAGGCTGTTGAAG133
R- AATAGGCTTGGCGACACTTGGC
HSLNM_214315.3F-GCCCGAGACGAGATTAGC143
R-ATGAAGGGATTCTTGACGATG
ATGLno. EU373817F-CGCCAGCATCATCGAGGTGTC94
R-GCAGCCACGGATGGTCTTCAC
DGAT1NM_214051.1F-GCTTCAGCCTTCTTCCACGAGTAC163
R-CGATGATGAGCGACAGCCACAC
METTL3XM_003128580.5F-CCAGCACAGCTTCAGCAGTTCC129
R-TGGAGATGGCAAGACGGATGGAG
METTL14XM_003129231.6F-GAGGAAGAGGTGGAACTTCTGCTG96
R-CTCCTCCACGGCCTCCTCTG
WTAPNM_001244241.1F-GCGGGAATAAGGCCTCCAAC136
R-TGTGAGTGGCGTGTGAGAGA
FTONM_001112692.1F-GCAGAGCCGCCTACAACCTAAC142
R-ACCGCTGACCTGTCCACCAG
ALKBH5XM_021067995.1F-GCAAGGTGAAGAGCGGCATCC128
R-GTCCACCGTGTGCTCGTTGTAC
YTHDF1XM_021078235.1F-GTCTACCTGCTCTTCAGCGTCAAC139
R-AGATCCACTTCACGTCGAACTTGC
YTHDF2XM_005665152.3F-CCACCTCCACCACAGCCTACTC140
R-CCAGCCTGAGACTGTCCTACTCC
YTHDF3XM_021089300.1F-ATTGAGCAAGGCATGACTGGACTG140
R-GGCGCTGCACTGCTAACTGG
β-actin397,563F-TGCGGGACATCAAGGAGAAG176
R-AGTTGAAGGTGGTCTCGTGG