Skip to main content

Table 2 Sequences of primers used for qRT-PCR in study

From: Effects of Royal Jelly and Tocotrienol Rich Fraction in obesity treatment of calorie-restricted obese rats: a focus on white fat browning properties and thermogenic capacity

Gene Forward Reverse
CREB-1 CTACAATATGCACAGACCACT GAGGACGCCATAACAACTCCA
p38MAPK GACCTAAAGCCCAGCAACCTC CGTAGCCGGTCATTTCGTCA
C/EBP β ACACGGGACTGACGCAAC AAACATCAACAGCAACAACCC
PRDM16 CCAAAACCGTGTGATAAGGTC GGGTATTTGGCACATTAACAAC
BMP7 TTCCTCACCGACGCCGACA AAGATCAAACCGGAACTCTCGAT
BMP8B TCGAGCACCACTAGCGACT GTTGCCACTGTCATCCGTCA
UCP-1 TTCTTTTCTGCGACTCGGAT GCCCAATGGTGTTTAGCATC
β-actin TCAGGTCATCACTATCGGCAA TTACGGATGTCAACGTCACAC