Skip to main content

Table 1 Primers used in qRT-PCR

From: MicroRNA-302a is involved in folate deficiency-induced apoptosis through the AKT-FOXO1-BIM pathway in mouse embryonic stem cells

  Primer Product size (bp)
miR-302a RT primer: 5′GTCGTATCCAGTGCGTGTCGTGGA
GTCGGCAATTGCACTGGATACGACTCACCAA3′
67
F: 5′GGGGTAAGTGCTTCCATGTT3′
R: 5′CAGTGCGTGTCGTGGAGT3′
U6 RT primer: 5′CGCTTCACGAATTTGCGTGTCAT3′ 89
F: 5′GCTTCGGCAGCACATATACTAAAAT3′
R: 5′CGCTTCACGAATTTGCGTGTCAT3′
AKT F: 5′GGCTGCTCAAGAAGGACCCTAC3′ 72
R: 5′GGTGCTGCATGATCTCCTTGG3′
FOXO1 F: 5′GTACAGCGCATAGCACCA3′ 121
R: 5′GCGACAGACAGAGTTCCC3′
Bim F: 5′GTTCTGCCGCCTTTCTG 3′ 189
R: 5′TTCCCCATCTGCTGCTAA 3′
miR-302a Promoter F: 5′GTTACCCTAATCTGTGCCATCAA3′ 284
R: 5′AAGACGCCGACTTTAGACCAC3′
β-actin F: 5′TTCCAGCCTTCCTTCTTG3′ 182
R: 5′GGAGCCAGAGCAGTAATC3′
\