Skip to main content

Table 1 Primers used in qRT-PCR

From: MicroRNA-302a is involved in folate deficiency-induced apoptosis through the AKT-FOXO1-BIM pathway in mouse embryonic stem cells

  Primer Product size (bp)
miR-302a Promoter F: 5′GTTACCCTAATCTGTGCCATCAA3′ 284