Skip to main content

Table 1 Primer list

From: A combination of herbal compound (SPTC) along with exercise or metformin more efficiently alleviated diabetic complications through down-regulation of stress oxidative pathway upon activating Nrf2-Keap1 axis in AGE rich diet-induced type 2 diabetic mice

Gene Forward primer (5′-3′) Reverse primer (5′–3′) Annealing temperature (°C)
Gpx1 TGAGAAGTGCGAAGTGAATGGTG TCTCAAAGTTCCAGGCAATGTCG 62
Txn CTCCCCGCAACAGCCAAA GCAGTCATCCACATCCACTTCAA 62
Nqo1 GCCAATCAGCGTTCGGTA AGTTCATAGCATAGAGGTCAGA 62
HO1 GGCTGTGAACTCTGTCTC ATACCCACCATCACACCCTG 56
18 s rRNA CGGACACGGACAGGATTG TCGCTCCACCAACTAAGAAC 59