Skip to main content

Table 1 PCR primers for quantitative real-time PCR

From: Weighted gene co-expression network analysis to identify key modules and hub genes related to hyperlipidaemia

Gene Forward primer Reverse primer
SQLE TCTGGGGGTTAAGAGCAGTG GTGTCTACACTTACCATCTGTGGC
SCD CTTGCGATATGCTGTGGTGC GGCTCCTAGCCTAATCCCCT
GAPDH GCAACTAGGATGGTGTGGCT TCCCATTCCCCAGCTCTCATA