Skip to main content

Table 1 The name and sequence of the primers, the sizes, and annealing temperatures for each pair

From: 1,25-Dihydroxyvitamin D3 modulates adipogenesis of human adipose-derived mesenchymal stem cells dose-dependently

Gene Size (bp) Sequence (5′→3′) Annealing temperature (°C)
GAPDH 113 F:CATGAGAAGTATGACAACAGCCT
R:AGTCCTTCCACGATACCAAAGT
58
PPARƔ 80 F:CAGAAATGCCTTGCAGTGGG
R:AACAGCTTCTCCTTCTCGGC
59
CEBPα 94 F:TATAGGCTGGGCTTCCCCTT
R:AGCTTTCTGGTGTGACTCGG
60
CEBPβ 154 F:TTTGTCCAAACCAACCGCAC
R:GCATCAACTTCGAAACCGGC
59
SREBP1c 117 F:TCTCAGTCCCCTGGTCTCTG
R:ATAGGCAGCTTCTCCGCATC
59
INSIG2 114 F:AGTGGTCCAGTGTAATGCGG
R:TGGATAGTGCAGCCAGTGTG
60
LPL 137 F:GCTCAGGAGCATTACCCAGTGTC
R:GCTCCAAGGCTGTATCCCAAGA
63
FASN 107 F:ATTCTGCCATAAGCCCTGTC
R:CTGTGTACTCCTTCCCTTCTTG
57
  1. GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; PPARγ: Peroxisome proliferator-activated receptor-gamma; C/EBPα: CCAAT-enhancer-binding protein-alpha; C/EBPβ: CCAAT-enhancer-binding protein- beta; SREBP1c: Sterol regulatory element-binding protein-1c; INSIG2: Insulin induced gene-2; FASN: Fatty acid synthase; LPL: lipoprotein lipase