Skip to main content

Table 1 Characteristics and performance data of the primers used for reference gene-stability measure M and qPCR

From: Supplementation of carnitine leads to an activation of the IGF-1/PI3K/Akt signalling pathway and down regulates the E3 ligase MuRF1 in skeletal muscle of rats

Gene Forward primer (5→3) Product size (bp) NCBI GenBank Slope R21 Efficiency2 M
  Reverse primer (5→3)    Liver Muscle Liver Muscle Liver Muscle Liver Muscle
Reference genes
ATP5B GCACCGTCAGAACTATTGCT 203 NM_134364.1 −0.31 −0.34 0.99 0.99 2.04 2.00 0.069 0.149
  GAATTCAGGAGCCTCAGCAT           
CANX CCAGATGCAGATCTGAAGAC 175 NM_172008.2 −0.32 −0.32 0.99 0.99 2.10 1.98 0.065 0.082
  CTGGGTCCTCAATTTCACGT           
MDH1 CAGACAAAGAAGAGGTTGCC 206 NM_033235.1 −0.32 −0.32 0.99 0.99 2.07 2.10 0.054 0.111
  CGTCAGGCAGTTTGTATTGG           
RPL13 CTTAAATTGGCCACGCAGCT 198 NM_031101.1 −0.23 −0.30 0.88 0.99 1.70 2.01 0.072 0.105
  CTTCTCAACGTCTTGCTCTG           
TOP1 GAAGAACGCTATCCAGAAGG 137 NM_022615.1 −0.29 −0.30 0.99 0.99 1.95 2.20 0.066 0.088
  GCTTTGGGACTCAGCTTCAT           
YWHAZ GACGGAAGGTGCTGAGAAA 198 NM_013011.3 −0.30 −0.30 0.98 0.99 2.02 2.08 0.057 0.082
  GCAGCAACCTCAGCCAAGT           
Target genes
IGF-1 CCCGGGACGTACCAAAATGAGCG 354 NM_001082477.2 −0.29   0.99   1.97    
  ATGTCAGTGTGGCGCTGGGC           
FBXO32 GACTGGACTTCTCGACTGCC 242 NM_133521.1   −0.29   0.98   1.94   
  GACTTGCCGACTCTCTGGAC           
TRIM63 AAGGCAGCCACCCGATGTGC 110 NM_080903.1   −0.31   0.99   2.02   
  GCCTGGTGAGCCCCGAACAC           
  1. 1Coefficient of determination of the standard curve.
  2. 2The efficiency was determined by [10-slope].
  3. ATP5B: ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide; CANX: calnexin; MDH1: soluble malate dehydrogenase; RPL13: ribosomal protein L13; TOP1: topoisomerase (DNA) I; YWHAZ: tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide; IGF-1: insulin-like growth factor 1; FBXO32: F-box protein 32; TRIM63: tripartite motif containing 63.