Skip to main content

Table 2 Primer sequences used for the determination of gene expression

From: Flaxseed oil ameliorated high-fat-diet-induced bone loss in rats by promoting osteoblastic function in rat primary osteoblasts

Gene
(Rats)
Primer sequence((5′ - 3′) Product bp
β-catenin Forward CATCACCACGCTGCATAATC 156
Reverse GAGCTTGCTTTCCTGATTGC  
RUNX2 Forward CATGGCCGGGAATGATGAG 148
Reverse TGTGAAGACCGTTATGGTCAAAGTG  
os0074erix Forward CACCCATTGCCAGTAATCTTCGT 97
Reverse GGACTGGAGCCATAGTGAGCTTCT  
β-actin Forward ACCCAGATCATGTTTGAGAC 99
Reverse GTCAGGATCTTCATGAGGTAGT  
  1. β-catenin, catenin beta1; RUNX2, runt-related transcription factor 2; osterix, Sp7 transcription factor; β-actin, actin, beta