Skip to main content
Download PDF

Protective effects of γ-aminobutyric acid against H2O2-induced oxidative stress in RIN-m5F pancreatic cells

Nutrition & Metabolism volume 15, Article number: 60 (2018) Cite this article

Abstract

Background

γ-Aminobutyric acid (GABA) is a major inhibitory neurotransmitter in the central nervous system and reported to maintain the redox homeostasis and insulin secretion function of pancreatic β cells. This study tested the hypothesis that GABA maintains cellular redox status, and modulates glycogen synthase kinase (GSK)-3β and antioxidant-related nuclear factor erythroid 2-related factor 2 (NRF2) nuclear mass ratio in the H2O2-injured RINm5F cells.

Methods

RINm5F cells were treated with/without GABA (50, 100 and 200 μmol/L) for 48 h and then exposed to 100 μmol/L H2O2 for 30 min. Viable cells were harvested, and dichloro-dihydro-fluorescein diacetate (DCFH-DA) was used to detect reactive oxygen species (ROS) level; cellular redox status and insulin secretion were measured; cell viability was determined by 3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay; mitochondrial membrane potential (MMP) was detected by flow cytometry; relative genes levels were analyzed by reverse transcriptase polymerase chain reaction (RT-PCR); western blotting was used to determine protein expression of GSK-3β and p-GSK-3β (Ser9), and nuclear and cytoplasmic NRF2.

Results

H2O2 increased ROS production, and induced adverse affects in relation to antioxidant defense systems and insulin secretion. These changes were restored by treatment with 100 and 200 μmol/L GABA. In addition, 100 or 200 μmol/L GABA induced membrane depolarization and increased cell viability. These effects were mediated by Caspase-3, Bcl-2 associated X protein (Bax) and B-cell lymphoma-2 (Bcl-2) expression. Western blotting indicated that GABA inhibited GSK-3β by increasing p-GSK-3β (Ser9) level, and directed the transcription factor NRF2 to the nucleus.

Conclusion

In rat insulin-producing RINm5F cells, GABA exerts its protective effect by regulating GSK-3β and NRF2, which governs redox homeostasis by inhibiting apoptosis and abnormal insulin secretion by exposure to H2O2.

Background

Type 1 diabetes (T1D) is an autoimmune disease characterized by pancreatic insulin-producing cells, which results in hyperglycemia [1]. At the onset of T1D, > 70% of β cells are destroyed, whereas the residual β-cells most likely represent the only reservoir for the regeneration of islet β-cell mass [2]. Oxidative stress is associated with the development of T1D and represents a central pathophysiological mediator of diabetes [3]. Compared with other tissues of the body, pancreatic β cells have lower levels of antioxidant enzymes, such as superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GSH-PX) activity, hence are more susceptible to pancreatic β-cell reactive oxygen species (ROS) damage [4]. Oxidative stress can also directly damage islet β cells and reduce the sensitivity of peripheral tissues to insulin. This results in an absolute or relative lack of insulin secretion, leading to abnormal blood glucose levels, and therefore is considered a major risk factor in the development and progression of diabetes [5]. Thus, there has been a growing interest in identifying endogenous antioxidant and growth factors for β-cell replication.

γ-Aminobutyric acid (GABA) is synthesized from glutamate by glutamic acid decarboxylase, is a major neurotransmitter in the central nervous system [6]. In the adult brain, GABA induces rapid inhibition in neurons, mainly through the GABAA receptor [7].GABA is also produced by the pancreas, and β cells are the main cells in the pancreas that secrete GABA [8]. GABA and insulin coexist in large dense-core vesicles of human islets, and the release of GABA in β cells is dependent on glucose concentration [9, 10]. GABA activates GABA receptors of pancreatic α cells by a paracrine mechanism, causing cell membrane hyperpolarization, suppression of glucagon, and prevention of high glucose concentration [11, 12]. GABA also activates GABA A receptors by an autocrine mechanism, causing membrane depolarization and increasing insulin secretion [13, 14]. Insulin counter-regulates GABAA receptor function, inhibiting GABA-induced insulin secretion [15], indicating that insulin can dual-directionally regulate islet β-cell GABA secretion.

GABA has a regulatory role in insulin secretion, and many studies have shown that it has a protective effect on islet β cells. Soltani et al. [16] reported that GABA therapy protects NOD mice against T1D. Remarkably, GABA also reverses established diabetes, which is most notable in streptozotocin-induced disease, whereas disease reversal in NOD mice is less prominent. The cellular and molecular mechanisms of these effects may be attributed to induction of membrane depolarization and Ca2+ influx by GABA, leading to activation of phosphoinositide 3-kinase (PI3K)/AKT-dependent growth and survival pathways in islet β cells [16]. PI3K/AKT are key molecules in the nuclear factor erythroid 2-related factor 2 (NRF2) -mediated regulation of antioxidative proteins. PI3K/AKT/NRF2 control the basal and induced expression of an array of antioxidant response-element-dependent genes to regulate the physiological and pathophysiological outcomes of oxidant exposure [17] suggesting that GABA improves antioxidative capacity under oxidative stress conditions. However, the role of GABA signaling in the regulation of β-cell antioxidant capability remains largely unknown. GABA has antioxidative activity, therefore, we hypothesized that GABA treatment can exert protection against H2O2-induced oxidative injury in islet β cells.

Material and methods

RINm5F culture: H2O2 exposure and GABA treatment

Mouse insulinoma RINm5F cells were cultured in RPMI 1640 medium (ICN, Eschwege, Germany) containing fetal bovine serum (10% v/v). All cell culture media were supplemented with 2 mmol/L L-glutamine, 100 mg/mL penicillin and 50 mg/mL streptomycin. Cells were maintained at 37 °C under humidified conditions of 95% air and 5% CO2.

On reaching 80% confluence, cells were treated (or not) with GABA (50, 100 or 200 μmol/L) alone for 48 h. After every 24 h, fresh aliquots of GABA were added to culture medium in all the experiments. Then, the cells were exposed to H2O2 (100 μmol/L) for 30 min in the presence or absence of GABA. Control cultures were grown under the same culture condition as treated cells, but in the absence of GABA and H2O2.

Analysis of the redox balance

For measurement of ROS production, control and treated cells were cultured in 96-well plates at a density of 1 × 104 cells per well, and incubated in 100 μL medium with 1‰ dichloro-dihydro-fluorescein diacetate (DCFH-DA) at 37 °C for 30 min. Mean fluorescence intensity (excitation wavelength 525 nm, emission wavelength 488 nm) was read by microtiter plate reader (Molecular Devices, Sunnyvale, CA, USA). Data were expressed as the mean percentage of viable cells versus the controls.

Cell lysates isolated from RINm5F cells were tested for total antioxidant capacity (T-AOC), SOD, CAT and GSH-PX activity, and malondialdehyde (MDA) content with the appropriate test kits obtained from Nanjing Jiancheng Bioengineering Institute (Nanjing, China).

Insulin secretion

After incubation with H2O2, in the presence or absence of GABA, the insulin secretion was assessed as previously described [18]. Cells were kept in 5.5 mmol/L glucose until the day of the experiment, then challenged with 22 mmol/L glucose or re-exposed to 5.5 mmol/L glucose for 1 h. The level of insulin in the culture medium was measured by mouse insulin ELISA kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) and normalized for the total cellular protein content detected in the pellet of each individual culture according to the Bradford method (Bio-Rad Laboratories, Stockholm, Sweden).

Mitochondrial membrane potential (MMP) measurements

The MMP of control and treated cells was determined by staining RINm5F cells with JC-1 (5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethyl-benzimidazolylcarbocyanine chloride), a lipophilic, cationic dye that exhibits a fluorescence emission shift upon aggregation from 530 nm (green monomer) to 590 nm (red J aggregates) [19]. In healthy cells with high MMP, JC-1 entered the mitochondrial matrix in a potential-dependent manner and formed aggregates. Cells were collected and stained by JC-1. After staining, cells were rinsed in 3× phosphate-buffered saline. The MMP was measured by flow cytometry (BD Biosciences, San Jose, CA, USA).

MTT assays

Cell viability was measured using blue formazan that was metabolized from colorless MTT (3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyl tetrazolium bromide) by mitochondrial dehydrogenases, which are active only in live cells. Cells were plated in 96-well plates at 70% confluence. After 12 h, cells were exposed to GABA and H2O2. MTT solution was added to the culture medium, and after 4 h, 150 μL of solubilization solution was added to each well and absorption values read at 490 nm on a microtiter plate reader (Molecular Devices). Data were expressed as the mean percentage of viable cells versus the controls.

RNA extraction and reverse transcriptase polymerase chain reaction (RT-PCR)

Total RNA was extracted from the cells with TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Total RNA was reverse-transcribed into cDNA using oligo-dT as a primer and MMLV reverse transcriptase, and 2 μL of the cDNA template was used to amplify the different mRNAs. ABI PRISM 7500 Sequence Detection System was used to perform real-time PCR. The PCR conditions were 95 °C for 5 min, followed by 45 cycles of 95 °C for 20 s, 62 °C for 30 s, and 72 °C for 20 s. The sequences of the oligonucleotide primers used in this study were as follows: Caspase-3 (forward, CTTATCCTTATACAAATCAGCTCGG; reverse, TCAAACCACATTCTCTCCAACTACA); Bcl-2 associated X protein (Bax) (forward, TGGAGATGAACTGGACAGCAATAT; reverse, GCAAAGTAGAAGAGGGCAACCAC); B-cell lymphoma-2 (Bcl-2) (forward, AACTCTAACTGTGCTTTGAAGGTGA; reverse, AGCTCAGAAGAGAACTTTAGTGGCT); Pancreatic and duodenal homeobox 1 (Pdx-1) (forward, CTCACCTCCACCACCACCTTCC; reverse, CACCTCCTGCCCACTGGCCTTT), v-maf musculoaponeurotic fibrosarcoma oncogene homolog A (Mafa) (forward, CATCACCACCACGGAGGCT; reverse, CGCACGGACATGGATACCA); Gamma-aminobutyric acid receptor subunit alpha2 (Gabra2) (forward, GCTTGGGACGGGAAGAGTGTAGT; reverse, GGAAAGATTCGGGGCATAGTTGG), β-actin (forward, GGGTCAGAAGGACTCCTATG; reverse, GTAACAATGCCATGTTCAAT). The relative expression levels of the target genes were calculated as a ratio to the housekeeping gene β-actin. Melting curve analysis was performed to assess the specificity of the amplified PCR products.

Western blotting

The whole cell extracts were obtained by using cell lysis buffer (Cell Signaling Technology, Beverly, MA, USA) with 0.5% protease inhibitor cocktail (Sigma, St Louis, MO, USA) and 1% phosphatase inhibitor cocktail I (Sigma). Nuclear and cytosolic fractions were separated using a nuclear and cytoplasmic protein extraction kit (Beyotime Biotechnology, Shanghai, China). Protein levels were measured using a bicinchoninic acid protein determination kit (Keygen Biotech, Nanjing, China). Total protein (60 μg) was applied to a 12% SDS-polyacrylamide gel. After electrophoresis and transfer to polyvinylidene fluoride membranes, the membranes were washed in Tris-buffered saline containing 0.1% Tween 20, and incubated with a primary antibody (rabbit anti-glycogen synthase kinase (GSK)-3β, rabbit anti-p-GSK-3β (Ser 9), rabbit or rabbit anti-NRF2 diluted at 1:1000; Santa Cruz Biotechnology, Santa Cruz, CA, USA). Membranes were incubated with a secondary antibody (1:1000), and immunostained bands were detected with a ProtoBlot II AP System and a stabilized substrate (Promega, Madison, WI, USA). GADPH and histone H3 was used as an internal control.

Statistical analysis

Data are representative of mean ± SD with three repeats. Comparisons across groups were carried out using one-way analysis of variance with the post-hoc Duncan’s test. p < 0.05 was considered to be statistically significant. Analysis of the data was achieved using SPSS version 13 (SPSS, Chicago, IL, USA).

Results

GABA reduces ROS level and restores oxidative redox status

To evaluate the protective activity of GABA against H2O2-induced oxidative stress, we analyzed ROS production by DCFH-DA assay. Exposure to 100 μmol/L H2O2 resulted in significant overproduction of ROS, with respect to cells cultured in the absence of H2O2 (Fig. 1). Importantly, 100 and 200 μmol/L GABA prevented H2O2-induced oxidative stress by significantly decreasing ROS production (P < 0.05).

Fig. 1
figure 1

GABA inhibits H2O2-induced ROS production. Results are the mean of at least three separate ROS assay. Values are means (n = 12), with standard errors represented by vertical bars. Means with different lower-case letters are significantly different (P < 0.05). Control, control medium; H2O2, medium containing 100 μM H2O2; H2O2 + (50 μM, 100 μM, 200 μM) GABA, medium containing 100 μM H2O2 and GABA; ROS, reactive oxygen species

Full size image

We next investigated the cellular antioxidant capacity (Table 1). H2O2 significantly decreased the activity of CAT, SOD, GSH-PX and T-AOC but increased MDA content in RINm5f cells (P < 0.05). When cells were treated with 100 or 200 μmol/L GABA, T-AOC, and CAT, SOD and GSH-PX activity were significantly increased and MDA content was significantly reduced (P < 0.05) compared to the H2O2 group. These changes were particularly seen in the H2O2 + 200 μmol/L GABA group.

Table 1 GABA causes an increment in the antioxidant status of RINm5F exposed to H2O2*
Full size table

GABA inhibits mitochondrial damage and cell death

We used flow cytometry to measure MMP by staining RINm5f cells with JC-1 (Fig. 2a). MTT assays were also used to measure cell viability (Fig. 2b). The cells treated with 100 μmol/L H2O2 showed significantly lower MMP compared to the control group (P < 0.05). A similar tendency was observed for cell viability. Pre-treatment with 50, 100 and 200 μmol/L GABA partially restored MMP and cell viability but they remained lower than in the control group (P < 0.05). Administration of GABA prevented the effect of H2O2 on this depolarization of MMP and cell death.

Fig. 2
figure 2

GABA inhibits mitochondrial damage and cell death. a mitochondrial membrane potential (MMP). Biparametric flow cytometry analysis after staining of living cells with JC-1. b Cell viabilities were analyzed by MTT assay. Data are shown as the mean ± SD of three independent experiments (n = 4). Means with different lower-case letters are significantly different (P < 0.05). Control, control medium; H2O2, medium containing 100 μM H2O2; H2O2 + (50 μM, 100 μM, 200 μM) GABA, medium containing 100 μM H2O2 and GABA

Full size image

RT-PCR was used to determine Caspase-3, Bax and Bcl-2 gene mRNA expression in RINm5f cells (Fig. 3). We found that 100 μmol/L H2O2 induced a significant increase in Caspase-3 and Bax expression, and a decrease in Bcl-2 expression. However, 100 or 200 μmol/L GABA prevented the increase in H2O2-induced Caspase-3 and Bax expression, and restored Bcl-2 expression (P < 0.05). GABA inhibited cell death by regulating the molecular targets involved in the apoptotic cascade inactivated by different apoptotic stimuli.

Fig. 3
figure 3

GABA regulates the mRNA expression of the major pro- and anti-apoptotic factors in RINm5F. Real-time quantitative measurement of Caspase-3 a Bax b and Bcl-2 c mRNA levels in RINm5F cells. Data are shown as the mean ± SD of three independent experiments (n = 4). Means with different lower-case letters are significantly different (P < 0.05). Control, control medium; H2O2, medium containing 100 μM H2O2; H2O2 + (50 μM, 100 μM, 200 μM) GABA, medium containing 100 μM H2O2 and GABA

Full size image

GABA protection of insulin-secreting RINm5F cells is associated with an increase of Pdx-1, MaFA and Cabra2 expression

To assess functional modifications, glucose-dependent secretion of insulin was evaluated in RINm5F cells in the presence or absence of GABA (Table 2). Insulin release from cells exposed only to H2O2 was markedly impaired in the absence of GABA (P < 0.05). Adding GABA did not modify basal insulin release (at 5.5 mmol/L glucose) as compared with GABA-untreated cells. When challenged with 22 mmol/L glucose, cells treated with 100 or 200 μmol/L GABA+H2O2 showed a significant increase in insulin release, as compared with H2O2-treated cells (P < 0.05).

Table 2 Insulin secretion from RINm5F cells in response to glucose (5.5 and 22 mmol/L) concentration*
Full size table

RT-PCR analysis of RINm5F cells revealed that GABA induced upregulation of transcription activating factors Mafa and Pdx-1, which are involved in regulation of glucose-stimulated insulin secretion (Fig. 4a and b). GABA A receptor (Gabra2) was also upregulated by 100 and 200 μmol/L GABA when the cells were exposed to H2O2 (Fig. 4c). These data suggest that the GABA protects insulinoma cells from H2O2 by regulating the different molecular targets involved in glucose-stimulated insulin secretion.

Fig. 4
figure 4

GABA modulates Pdx-1 a Mafa b and Gabra2 c mRNA expression. Results are the mean of at least three separate experiments. Values are means (n = 4), with standard errors represented by vertical bars. Means with different lower-case letters are significantly different (P < 0.05). Control, control medium; H2O2, medium containing 100 μM H2O2; H2O2 + (50 μM, 100 μM, 200 μM) GABA, medium containing 100 μM H2O2 and GABA

Full size image

GABA exerts antioxidative effects through GSK/3β and NRF2

GSK-3β is tightly regulated by the survival pathway represented by PI3K/AKT. Activation of PI3K/AKT leads to inactivation of GSK/3β by phosphorylation of its Ser9 residue [20]. Phosphorylation of GSK/3β at Ser9 is associated with regulation of many important metabolic and signaling proteins, structural proteins and transcription factors [21]. To determine whether GABA-regulated cell antioxidative activity was associated with phosphorylation of GSK/3β, western blotting with antibody specific for p-GSK-3β (Ser9) was performed (Fig. 5a). GABA (100 and 200 μmol/L) downregulated the protein level of GSK-3β, while phosphorylation at Ser9 was upregulated by GABA, for the indicated concentrations. GSK-3β is the main protein responsible for maintaining NRF2 in the cytoplasm. Inhibition of NRF2 by GSK-3β limits the cell response to oxidative stress [22]. As shown in Fig. 5b, H2O2 induced low accumulation of NRF2 in the nucleus. GABA treatment of RINm5F cells at a concentration of 100 and 200 μmol/L gradually increased nuclear NRF2. A maximum nuclear mass ratio was achieved with 200 μmol/L GABA. The results indicate that GABA prevents, at least partially, the H2O2-induced cytosolic localization of NRF2.

Fig. 5
figure 5

GABA regulates GSK-3β and prevents the H2O2-induced redistribution of NRF2 towards the nucleus. GSK-3β and p-GSK/3β (ser9) protein a and cytosolic and nuclear NRF2 protein b were evaluated by western blot. The relative amount of NRF2 was calculated as the ratio between nuclear and cytosolic levels (ratio N/C). Data are shown as the mean ± SD of three independent experiments (n = 4). Means with different lower-case letters are significantly different (P < 0.05)

Full size image

Discussion

GABA is the primary inhibitory neurotransmitter in the mammalian central nervous system, and activation of GABAA receptors (GABAARs) by GABA tends to decrease neuronal excitability [23]. GABA is mainly synthesized from glutamic acid by glutamic acid decarboxylase (GAD) [24]. The GABA signalling system is an integral part of a system in human islets maintaining glucose homeostasis [25].

Human islets express GABA A and B receptors [26, 27]. On the one hand, GABA suppress glucagon secretion in islet cells by activating GABAA receptors [27]. On the other hand, GABA can also be activated by autocrine GABA A receptors, causing cell membrane depolarization and increasing insulin secretion [28]. Robertson et al. [29] have reported that ROS damage the nuclei and mitochondria of islet β cells, and reduce Pdx-1 gene expression and its binding activity to DNA by inhibiting activity of the insulin gene promoter, which further reduces insulin gene expression, leading to decreased insulin synthesis. In the present study, oxidative stress was generated by the addition of H2O2 as a direct oxidant. Insulin release from cells exposed only to H2O2 was markedly decreased as compared to the control group. GABA induces mRNA expression of GABA A2 receptor and transcription activating factors Mafa and Pdx-1, which is involved in the regulation of glucose-stimulated insulin secretion. GABA also improves insulin secretion and viability of RIN5mF cells. When GABA is given to mice with T1D, it restores β cells, completely reverses the symptoms of hyperglycemia and cures diabetes, associated with elevated insulin levels and reduced glucagon levels [16]. These effects of GABA could be attributed to its synergy of insulin by activating the PI3K/AKT pathway and increasing β-cell proliferation and survival [15].

Oxidative stress is considered an important mediator of cellular damage following prolonged exposure of pancreatic β cells to elevated levels of H2O2 [30]. Our observations, consistent with previous reports [28, 29], demonstrated that exposure to H2O2 resulted in significant overproduction of ROS in RINm5F cells when compared with untreated cells. Our results also showed that H2O2 strongly reduced T-AOC and activity of CAT, SOD and GSH-PX antioxidant enzymes in RIN5mF cells, while it increased the level of MDA, a lipid oxidation product. It has been demonstrated that pancreatic β cells are especially sensitive to oxidative stress because of their low levels of antioxidant enzymes [31]. Several studies have shown that β-cell death induced by oxidative stress may play an important role in pathogenesis of both type 1 and type 2 diabetes [32, 33]. Antioxidant treatment may improve impaired β-cell function in response to high glucose concentration [4].

Our data suggest that GABA exerts its protective effect by strengthening the intrinsic antioxidant defenses of RINm5F cells through modulation of antioxidant enzymes, thus protecting them by acting on the redox status. This hypothesis is supported by previous studies showing that in red algae amino acid induced by nerve injury research, GABA has a protective role by reducing cellular ROS and MDA levels in kainic acid-induced status epilepticus [34]. GABA inhibits neural NO synthesis in rat ileum by GABA A and GABA C (Aρ) receptor-mediated mechanisms [35]. GABA significantly increases SOD and GSH-PX activity, reduces MDA level, and scavenges free radicals in vivo and in vitro [36].

ROS-induced oxidative stress is an important cause of apoptosis. Long-term high blood sugar and oxidative damage reduce islet β-cell synthesis and secretion of insulin, and reduce the number of islet β cells; both of which increase the development of diabetes [5]. It has been demonstrated that loss of MMP is indicative of apoptosis and precedes phosphatidylserine externalization and caspase activation [37]. In the present study, the possibility that the effect of GABA might involve apoptotic pathways was suggested by measurements of MMP. Our data showed that GABA strongly attenuated depolarization of the mitochondrial membrane in a significant number of H2O2-treated cells. Evidence for the possibility that GABA reduces apoptosis was obtained by data showing a decrease in Caspase-3 expression in response to H2O2. Caspase-3 has been identified as a key mediator of apoptosis of mammalian cells. It can activate death protease and catalyze the specific cleavage of many key cellular proteins [38]. Inhibition of Caspase-3 with GABA abolished the increase in cell death induced by H2O2, which suggests that part of the GABA effect is associated with regulation of Caspase-3 expression. In human and rodent islets, members of the Bcl-2 family modulate apoptosis, with the Bax/Bcl-2 ratio determining cell susceptibility to apoptosis [39]. It has been suggested that overexpression of Bcl-2 protein enhances islet viability [40]. The present study showed that 50 or 200 μmol/L GABA significantly upregulated Bcl-2 expression in RIN5mF cells. Conversely, Bax expression was significantly decreased in cells treated with GABA, as compared to the H2O2 group. Moreover, Bcl-2 protected cells from H2O2-induced oxidative death through regulation of cellular antioxidant enzymes (e.g., SOD and CAT) [41, 42]. These results indicate that GABA-induced antioxidative activity in pancreatic β cells may involve mechanisms dependent upon Bcl-2. This requires further investigation.

GSK-3β is involved in regulation of glycogen metabolism. It not only affects glycogen synthesis, but also gene transcription, cell division and multiplication, and plays an indispensable role in the process, which involves in many diseases occurrence and development [43, 44]. GSK-3β overexpression inhibits β-cell proliferation in mice, and induces diabetes [45]. On the contrary, inhibition of GSK-3β prevents the onset of diabetes by improving glucose tolerance and β-cell function [46]. Regulation of GSK-3β activity is critically dependent on the phosphorylation state of its Ser9 residue, which is located at the pseudosubstrate domain. Phosphorylation of Ser9 by several kinases, including AKT, results in inhibition of GSK-3β activity [47]. We showed that p-GSK-3β (Ser9) level was increased by GABA when the cells were exposed to H2O2, suggesting that GABA inhibits GSK-3β activity to improve β-cell function.

Oxidative stress has been shown to regulate PI3K/AKT and, consequently, to alter the downstream signaling events in cultured cells [48]. The PI3K/AKT/GSK-3β axis is essential for the H2O2-induced nuclear translocation of NRF2. H2O2 downregulates AKT and activates GSK-3β, together with relocation of NRF2 back to the cytosol [22]. GSK-3β is the main protein responsible for maintaining NRF2 in the cytoplasm [43]. In the present study, we explored the possibility that GABA might regulate the nuclear–cytoplasmic shuttling cycle of NRF2. H2O2 treatment increased the amount of cytosolic NRF2. However, when GABA was added, NRF2 was redistributed mostly to the nucleus, suggesting that GABA produces high accumulation of NRF2 in the nucleus, thus restoring oxidative redox status under oxidative stress and maintaining cellular function.

Conclusions

In conclusion, Our results show that GABA inactivates GSK-3β, with subsequent redistribution of NRF2 towards the nucleus. This may represent a mechanism underlying its in vitro effects in promoting β-cell antioxidant capacity, survival and function.

Abbreviations

GABA:

γ-Aminobutyric acid

CAT:

Catalase

GSH-PX:

Glutathione peroxidase

GSK-3β:

glycogen synthase kinase-3β

MDA:

Malondialdehyde

NRF2:

Nuclear factor erythroid 2-related factor 2

ROS:

Reactive oxygen species

SOD:

Superoxide dismutase

T1D:

Type 1 diabetes

T-AOC:

Total antioxidant capacity

References

  1. Hober D, Sane F. Enteroviral pathogenesis of type 1 diabetes. Discov Med. 2010;10:151–60.

    PubMed  Google Scholar 

  2. Meier JJ, Lin JC, Butler AE, Galasso R, Martinez DS, Butler PC. Direct evidence of attempted beta cell regeneration in an 89-year-old patient with recent-onset type 1 diabetes. Diabetologia. 2006;49:1838–44.

    Article  PubMed  CAS  Google Scholar 

  3. Butterfield DA, Di Domenico F, Barone E. Elevated risk of type 2 diabetes for development of Alzheimer disease: a key role for oxidative stress in brain. Biochim Biophys Acta. 2014;1842:1693–706.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  4. Kaneto H, Kajimoto Y, Miyagawa J, Matsuoka T, Fujitani Y, Umayahara Y, et al. Beneficial effects of antioxidants in diabetes - possible protection of pancreatic beta-cells against glucose toxicity. Diabetes. 1999;48(12):2398–406.

    Article  PubMed  CAS  Google Scholar 

  5. Rains JL, Jain SK. Oxidative stress, insulin signaling, and diabetes. Free Radic Biol Med. 2011;50:567–75.

    Article  PubMed  CAS  Google Scholar 

  6. Kittler JT, Moss SJ. Modulation of GABAA receptor activity by phosphorylation and receptor trafficking: implications for the efficacy of synaptic inhibition. Curr Opin Neurobiol. 2003;13:341–7.

    Article  PubMed  CAS  Google Scholar 

  7. Owens DF, Kriegstein AR. Is there more to GABA than synaptic inhibition? Nat Rev Neurosci. 2002;3:715–27.

    Article  PubMed  CAS  Google Scholar 

  8. Adeghate E, Ponery AS. GABA in the endocrine pancreas: cellular localization and function in normal and diabetic rats. Tissue Cell. 2002;34:1–6.

    Article  PubMed  CAS  Google Scholar 

  9. Braun M, Ramracheya R, Bengtsson M, Clark A, Walker JN, Johnson PR, et al. Gamma-aminobutyric acid (GABA) is an autocrine excitatory transmitter in human pancreatic beta-cells. Diabetes. 2010;59:1694–701.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  10. Winnock F, Ling Z, De Proft R, Dejonghe S, Schuit F, Gorus F, et al. Correlation between GABA release from rat islet beta-cells and their metabolic state. Am J Physiol Endocrinol Metab. 2002;282:E937–42.

    Article  PubMed  CAS  Google Scholar 

  11. Xu E, Kumar M, Zhang Y, Ju W, Obata T, Zhang N, et al. Intra-islet insulin suppresses glucagon release via GABA-GABAA receptor system. Cell Metab. 2006;3:47–58.

    Article  PubMed  CAS  Google Scholar 

  12. Michalik M, Erecinska M. GABA in pancreatic islets: metabolism and function. Biochem Pharmacol. 1992;44:1–9.

    Article  PubMed  CAS  Google Scholar 

  13. Dong H, Kumar M, Zhang Y, Gyulkhandanyan A, Xiang YY, Ye B, et al. Gamma-aminobutyric acid up- and downregulates insulin secretion from beta cells in concert with changes in glucose concentration. Diabetologia. 2006;49:697–705.

    Article  PubMed  CAS  Google Scholar 

  14. Leibiger IB, Leibiger B, Berggren PO. Insulin signaling in the pancreatic beta-cell. Annu Rev Nutr. 2008;28:233–51.

    Article  PubMed  CAS  Google Scholar 

  15. Bansal P, Wang S, Liu S, Xiang YY, Lu WY, Wang Q. GABA coordinates with insulin in regulating secretory function in pancreatic INS-1 beta-cells. PLoS One. 2011;6:e26225.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  16. Soltani N, Qiu H, Aleksic M, Glinka Y, Zhao F, Liu R, et al. GABA exerts protective and regenerative effects on islet beta cells and reverses diabetes. Proc Natl Acad Sci U S A. 2011;108:11692–7.

    Article  PubMed  PubMed Central  Google Scholar 

  17. Ma Q. Role of nrf2 in oxidative stress and toxicity. Annu Rev Pharmacol Toxicol. 2013;53:401–26.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  18. Anastasi E, Santangelo C, Bulotta A, Dotta F, Argenti B, Mincione C, et al. The acquisition of an insulin-secreting phenotype by HGF-treated rat pancreatic ductal cells (ARIP) is associated with the development of susceptibility to cytokine-induced apoptosis. J Mol Endocrinol. 2005;34:367–76.

    Article  PubMed  CAS  Google Scholar 

  19. Smiley ST, Reers M, Mottola-Hartshorn C, Lin M, Chen A, Smith TW, et al. Intracellular heterogeneity in mitochondrial membrane potentials revealed by a J-aggregate-forming lipophilic cation JC-1. Proc Natl Acad Sci U S A. 1991;88:3671–5.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  20. Rylatt DB, Aitken A, Bilham T, Condon GD, Embi N, Cohen P. Glycogen synthase from rabbit skeletal muscle. Amino acid sequence at the sites phosphorylated by glycogen synthase kinase-3, and extension of the N-terminal sequence containing the site phosphorylated by phosphorylase kinase. Eur J Biochem. 1980;107:529–37.

    Article  PubMed  CAS  Google Scholar 

  21. Frame S, Cohen P. GSK3 takes centre stage more than 20 years after its discovery. Biochem J. 2001;359(1):16.

    Article  Google Scholar 

  22. Rojo AI, Sagarra MR, Cuadrado A. GSK-3beta down-regulates the transcription factor Nrf2 after oxidant damage: relevance to exposure of neuronal cells to oxidative stress. J Neurochem. 2008;105:192–202.

    Article  PubMed  CAS  Google Scholar 

  23. Han JS, Park MJ, Song YS. Protective effects of the BuOH fraction from laminaria japonica extract on high glucose-induced oxidative stress in human umbilical vein endothelial cells. J Food Sci Nutr. 2006;11:94–9.

    Google Scholar 

  24. Rolo AP, Palmeira CM. Diabetes and mitochondrial function: role of hyperglycemia and oxidative stress. Toxicol Appl Pharmacol. 2006;212:167–78.

    Article  PubMed  CAS  Google Scholar 

  25. Taneera J, Jin Z, Jin Y, Muhammed SJ, Zhang E, Lang S, et al. γ-Aminobutyric acid (GABA) signalling in human pancreatic islets is altered in type 2 diabetes. Diabetologia. 2012;55:1985–94.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  26. Yang W, Reyes AA, Lan NC. Identification of the GABAA receptor subtype mRNA in human pancreatic tissue. FEBS Lett. 1994;346:257–62.

    Article  PubMed  CAS  Google Scholar 

  27. Robertson RP, Harmon J, Tran PO, Tanaka Y, Takahashi H. Glucose toxicity in beta-cells: type 2 diabetes, good radicals gone bad, and the glutathione connection. Diabetes. 2003;52:581–7.

    Article  PubMed  CAS  Google Scholar 

  28. Lapidot TM, Walker MD, Kanner J. Antioxidant and prooxidant effects of phenolics on pancreatic beta-cells in vitro. J Agr Food Chem. 2002;50:7220–5.

    Article  CAS  Google Scholar 

  29. Sampson SR, Bucris E, Horovitz-Fried M, Parnas A, Kahana S, Abitbol G, et al. Insulin increases H2O2-induced pancreatic beta cell death. Apoptosis. 2010;15(10):1165–76.

    Article  PubMed  CAS  Google Scholar 

  30. Verga Falzacappa C, Panacchia L, Bucci B, Stigliano A, Cavallo MG, Brunetti E, et al. 3,5,3′-triiodothyronine (T3) is a survival factor for pancreatic beta-cells undergoing apoptosis. J Cell Physiol. 2006;206:309–21.

    Article  PubMed  CAS  Google Scholar 

  31. Lenzen S, Drinkgern J, Tiedge M. Low antioxidant enzyme gene expression in pancreatic islets compared with various other mouse tissues. Free Radical Bio Med. 1996;20:463–6.

    Article  CAS  Google Scholar 

  32. Robertson RP, Harmon JS. Diabetes, glucose toxicity, and oxidative stress: a case of double jeopardy for the pancreatic islet beta cell. Free Radical Bio Med. 2006;41:177–84.

    Article  CAS  Google Scholar 

  33. Mandrup-Poulsen T. Apoptotic signal transduction pathways in diabetes. Biochem Pharmacol. 2003;66:1433–40.

    Article  PubMed  CAS  Google Scholar 

  34. Hou CW. Pu-Erh tea and GABA attenuates oxidative stress in kainic acid-induced status epilepticus. J Biomed Sci. 2011;18:75.

  35. Kurjak M, Fichna J, Harbarth J, Sennefelder A, Allescher HD, Schusdziarra V, et al. Effect of GABA-ergic mechanisms on synaptosomal NO synthesis and the nitrergic component of NANC relaxation in rat ileum. Neurogastroent Motil. 2011;23:e181–e90.

    Article  CAS  Google Scholar 

  36. Deng Y, Wang W, Yu PF, Xi ZJ, Xu LJ, Li XL, et al. Comparison of taurine, GABA, Glu, and asp as scavengers of malondialdehyde in vitro and in vivo. Nanoscale Res Lett. 2013;8:190.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  37. Dogliotti G, Galliera E, Dozio E, Vianello E, Villa RE, Licastro F, et al. Okadaic acid induces apoptosis in Down syndrome fibroblasts. Toxicol in Vitro. 2010;24:815–21.

    Article  PubMed  CAS  Google Scholar 

  38. Porter AG, Janicke RU. Emerging roles of caspase-3 in apoptosis. Cell Death Differ. 1999;6(2):99–104.

    Article  PubMed  CAS  Google Scholar 

  39. Salakou S, Kardamakis D, Tsamandas AC, Zolota V, Apostolakis E, Tzelepi V, et al. Increased Bax/Bcl-2 ratio up-regulates caspase-3 and increases apoptosis in the thymus of patients with myasthenia gravis. In Vivo. 2007;21:123–32.

    PubMed  CAS  Google Scholar 

  40. Rabinovitch A, Suarez-Pinzon W, Strynadka K, Ju QD, Edelstein D, Brownlee M, et al. Transfection of human pancreatic islets with an anti-apoptotic gene (bcl-2) protects beta-cells from cytokine-induced destruction. Diabetes. 1999;48:1223–9.

    Article  PubMed  CAS  Google Scholar 

  41. Hockenbery DM, Oltvai ZN, Yin XM, Milliman CL, Korsmeyer SJ. Bcl-2 functions in an antioxidant pathway to prevent apoptosis. Cell. 1993;75:241–51.

    Article  PubMed  CAS  Google Scholar 

  42. Deng XM, Gao FQ, May WS. Bcl2 retards G1/S cell cycle transition by regulating intracellular ROS. Blood. 2003;102:3179–85.

    Article  PubMed  CAS  Google Scholar 

  43. Jain AK, Jaiswal AK. GSK-3beta acts upstream of Fyn kinase in regulation of nuclear export and degradation of NF-E2 related factor 2. J Biol Chem. 2007;282:16502–10.

    Article  PubMed  CAS  Google Scholar 

  44. Sutherland C, Leighton IA, Cohen P. Inactivation of glycogen synthase kinase-3 beta by phosphorylation: new kinase connections in insulin and growth-factor signalling. Biochem J. 1993;296:15–9.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  45. Liu Z, Tanabe K, Bernal-Mizrachi E, Permutt MA. Mice with beta cell overexpression of glycogen synthase kinase-3 beta have reduced beta cell mass and proliferation. Diabetologia. 2008;51:623–31.

    Article  PubMed  CAS  Google Scholar 

  46. Feng ZC, Donnelly L, Li J, Krishnamurthy M, Riopel M, Wang R. Inhibition of Gsk3beta activity improves beta-cell function in c-KitWv/+ male mice. Lab Investig. 2012;92:543–55.

    Article  PubMed  CAS  Google Scholar 

  47. Woodgett JR. Recent advances in the protein kinase B signaling pathway. Curr Opin Cell Biol. 2005;17:150–7.

    Article  PubMed  CAS  Google Scholar 

  48. Wang L, Chen Y, Sternberg P, Cai J. Essential roles of the PI3 kinase/Akt pathway in regulating Nrf2-dependent antioxidant functions in the RPE. Invest Ophthalmol Vis Sci. 2008;49:1671–8.

    Article  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

Dr. Jin Sun, Jiangnan University, is acknowledged for his skillful technical assistance. Kai Zhang and Yiping Lv at the Department of Comparative Medicine, Jiangnan University, were responsible for daily cell culture. The publication charges for this article have been funded by a grant from the publication fund of Wuxi Municipal Commission of Health and Family Planning Medical Key Discipline Program.

Funding

The study was supported by the Wuxi Municipal Scinece and Education Qiang Wei Engineering Medical Key Discipline Program (ZDXK003), Medical Foundation for Youths (QNRC039 and Q201613) and 12th Five-Year Plan for Science and Technology Development (No. 2012BAD33B05).

Availability of data and materials

All data used in the current study are available from the corresponding author on reasonable request.

Author information

Authors and Affiliations

  1. State Key Laboratory of Food Science and Technology, Jiangnan University, Wuxi, 214122, Jiangsu, China

    Xue Tang & Guowei Le

  2. The Affiliated Wuxi Maternity and Child Health Care Hospital of Nanjing Medical University, Wuxi, 214002, Jiangsu, China

    Renqiang Yu, Qin Zhou & Shanyu Jiang

  3. School of Food Science and Technology, Jiangnan University, Wuxi, 214122, Jiangsu, China

    Xue Tang & Guowei Le

Authors
  1. Xue Tang
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Renqiang Yu
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Qin Zhou
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Shanyu Jiang
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Guowei Le
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

YRQ and LGW conceived and designed the experiments; TX, ZQ and JSY performed the experiments; TX analyzed the data, YRQ and LGW contributed reagents/materials/analysis tools; TX and YRQ wrote the paper. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Renqiang Yu.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

The authors consent to the publication of the data.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Tang, X., Yu, R., Zhou, Q. et al. Protective effects of γ-aminobutyric acid against H2O2-induced oxidative stress in RIN-m5F pancreatic cells. Nutr Metab (Lond) 15, 60 (2018). https://doi.org/10.1186/s12986-018-0299-2

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12986-018-0299-2

Keywords

Nutrition & Metabolism

ISSN: 1743-7075

Contact us